October 2018 - Pharo-users - lists.pharo.org

Re: [Pharo-users] SQL Server
by linkerstorm Dec. 23, 2018

Dec. 23, 2018

Thanks. Following your suggestion, I found this thread, with the same problem : https://groups.google.com/forum/#!topic/dbxtalk/xoQILQhu_mo <https://groups.google.com/forum/#!topic/dbxtalk/xoQILQhu_mo> I'm not alone anymore -- Sent from: http://forum.world.st/Pharo-Smalltalk-Users-f1310670.html

2 2

StCAD is open source
by askoh Dec. 15, 2018

Dec. 15, 2018

Hi: I have just open source StCAD (MIT license) which has the code for freeCAD. http://askoh.com/stcad Although written in VisualWorks Smalltalk, I hope Pharo users will port it in part or whole. All the best, Aik-Siong Koh What is 'StCAD'? 'StCAD' is a basic 3D CAD framework in Smalltalk (VisualWorks 8.x). It extends the GF/ST 2D drawing framework into 3D. It also include 'StCAD-Geo' which is the 3D geometric domain, 'StCAD-Math' which provides the mathematical support for 3D CAD and motion simulation computations, and 'StCAD-Doc' which is a simple word processor. 'StCAD-Math' is also suitable for engineering, scientific and business computing. The parcels are open source using MIT License. Users can use these parcels with other private software to create 3D applications like motion simulation, finite element analysis, CAD, scientific visualization, etc. 'StCAD' allows users to create and manipulate assemblies, which are collections of 3D parts. The parts are 3D solids, which can be connected by joints, constraints, contacts, actuators, springs, dampers or forces. The parts and connections define the structure or mechanism that the assembly is meant to represent. Animation is possible, if the user can provide time series of position and orientation data for the parts. Users can also obtain output data in the form of plots and tables. XY plots can be zoomed and set to equal scales. Data series available include linear and angular displacements, velocities, accelerations and other user generated data. 'StCAD' has been used to create a freeware called 'freeCAD' which is a 3D CAD with Motion Simulation. For more information visit: http://www.askoh.com -- Sent from: http://forum.world.st/Pharo-Smalltalk-Users-f1310670.html

5 6

About the IoT Hackathon last Friday
by Sven Van Caekenberghe Nov. 24, 2018

Nov. 24, 2018

Last Friday we went to the IoT Hackathon in KÃ¶ln and it was a great experience. Thank you Norbert, Christian, Markus and the whole ZweiDenker team for their generous hospitality: the accommodations where great (beautiful office), the food and drinks super tasty, everybody friendly and welcoming. Thank you Allex (Oliviera, Inria/RMOD) for running the workshop and for being so patient, friendly and tireless in helping everyone with all aspects of getting experiments up and running. I knew about PharoThings [1] and TelePharo [2] before, but actually using it in practice to experience connecting software and hardware felt a bit like magic. Thank you Denis (Kudriashov) and Inria/RMOD for developing these packages. Sven [1] https://github.com/pharo-iot/PharoThings [2] https://github.com/pharo-ide/TelePharo

7 10

MetaLink>>level: failing?
by Vitor Medina Cruz Nov. 22, 2018

Nov. 22, 2018

Hello, I am playing with MetaLink, really cool!, but I am having issues that I am unsure if it's some erro or if I am doing something wrong (I am using Pharo 6.1 32 bits in windows.). Consider: TestMetaLink>>execute UIManager default alert: 'Actual Version'. And in Playground: | link | link := MetaLink new metaObject: [ :object | UIManager default alert: 'Linked Version' ]; selector: #value:; arguments: #(#object); control: #instead. (TestMetaLink >> #execute) ast link: link. TestMetaLink new execute. link uninstall. This works as expected, an alert with 'Linked Version' is promped. But then suppose I want to execute the actual node alongside with the linked one considering some condition: | link choice | choice := true. link := MetaLink new metaObject: [ :object :selector :arguments | UIManager default alert: 'Linked Version'. choice ifTrue: [ object perform: selector withArguments: arguments]. ]; selector: #value:value:value:; arguments: #(#object #selector #arguments); control: #instead; * level: 0*. (TestMetaLink >> #execute) ast link: link. TestMetaLink new execute. link uninstall. As I understand, level:0 is necessary in order to avoid an infinite loop, but then I get an error: KeyNotFound: key #RFArgumentsReificationVar not found in Dictionary Am I doing something wrong? Is that an error? Best Regards, Vitor

2 6

glamorous toolkit alpha.2
by Tudor Girba Nov. 1, 2018

Nov. 1, 2018

Hi, Glamorous Toolkit has evolved quite a bit over the past months, and we now would like to announce that we reached alpha.2 version. It runs on top of Pharo 7: feenk.com/gt There quite a number of new things. Some highlights are: - We added extensive documentation for GT, Bloc and Brick. By running "GtWorld openTourâ you essentially transform the image into an elaborate wiki. - We worked on Coder, a new set of tools that are dedicated for affecting code. For example, in the picture below we see an editor on embedded examples that can be edited and run independently. And this one shows how we can visualize and edit the result of querying. Just a note: To make Coder work the way we want, we extended Brick with several widgets, and enhanced significantly the linear and grid layouts. - We added the first version of xdoc in order to serialize the Playground every time you evaluate something. As always, we are looking forward to your feedback. Have fun, The feenk team -- www.feenk.com -- www.feenk.com "Every thing should have the right to be different."

3 2

Http persistent connections
by Jimmie Houchin Oct. 31, 2018

Oct. 31, 2018

Hello, I am writing an app which accesses a REST api. The documentation says this. Connection Limits To provide equal resources to all clients, we recommend limiting both the number of new connections per second, and the number of requests per second made on a persistent connection (see above/below). For new connections, we recommend you limit this to twice per second (2/s). Establishing a new TCP and SSL connection is expensive for both client and server. To allow a better experience, using a persistent connection will allow more requests to be performed on an established connection. For an established connection, we recommend limiting this to one hundred per second (100/s). Please see following section on persistent connections to learn how to maintain a connection once it is established. HTTP Persistent Connection This keeps the underlying TCP connection active for multiple requests/responses. Subsequent requests will result in reduced latency as the TCP handshaking process is no longer required. If you are using an HTTP 1.0 client, ensure it supports the keep-alive directive and submit the header |Connection: Keep-Alive| with your request. Keep-Alive is part of the protocol in HTTP 1.1 and enabled by default on compliant clients. However, you will have to ensure your implementation does not set the connection header to other values. I do not know how to reuse a connection. I see in ZnClient #canReuseConnection and #connectionReuseTimeout. Is the timeout from connection time or last request or access time? Does that handle everything automatically for me? I will be accessing this api multiple times a minute, sometimes multiple times a second for almost all the time. How long can I keep a persistent connection open? What are best practices? Any help and wisdom greatly appreciated. Thanks. Jimmie

2 2

Fwd: Plotting genome scale values with Roassal
by HernÃ¡n Morales Durand Oct. 29, 2018

Oct. 29, 2018

Hi, I have a couple of Roassal questions regarding how to customize the plots of a genome metric known as GC skew, and how to scale the visualization to cover a (bacterial) genome scale data. For a toy example, I have isolated a Roassal sample code below from BioSmalltalk to show how I did an initial GC skew graphic: | b values ds | values := 'GGCTGCGTTCCCCTCAGTTAGCGCCTATCCTAAGCAGATCTGTAGTTAGTACTGTCTAAGCTTGTTAGACTACTCGGAACTTGCTGATATTAACCTTACCCCCGTCGAAACGCTTATTCCGCTTTGCTACTTCAAGCCCTGTAACATCTACTGTACTGACAAGGTTGCAGTAGCAATTGGCAAGGCTGTTTGGCATCTCAGATGACAGTTACCCGTGTTGCGCTCACCCGCAGCGACTCTCGGATACGTAACGCAGAAGACGTCTTCCGCGAGATTTGGGCGCGTCTGTCCACCTTCCCAGGTTGGCATTGGCAGAAGCTCTATCCGGCTTTGTTCCTCTAGCGGCTCCGCA' asDNASimpleSequence gcSkewInt. values := #(0 1 2 1 1 2 1 2 2 2 1 0 -1 -2 -2 -3 -3 -2 -2 -2 -2 -1 -2 -1 -2 -3 -3 -3 -3 -4 -5 -5 -5 -5 -4 -5 -5 -4 -4 -4 -5 -5 -4 -4 -4 -3 -3 -3 -3 -2 -2 -2 -3 -3 -2 -2 -3 -3 -3 -3 -2 -3 -3 -3 -2 -2 -2 -2 -1 -1 -2 -2 -2 -3 -3 -4 -3 -2 -2 -2 -3 -3 -3 -2 -3 -3 -2 -2 -2 -2 -2 -2 -2 -2 -3 -4 -4 -4 -4 -5 -6 -7 -8 -9 -8 -8 -9 -8 -8 -8 -8 -9 -8 -9 -9 -9 -9 -9 -9 -10 -11 -10 -11 -11 -11 -11 -10 -11 -11 -11 -12 -12 -12 -13 -13 -13 -12 -13 -14 -15 -15 -14 -14 -14 -14 -15 -15 -15 -16 -16 -16 -17 -17 -16 -16 -16 -17 -17 -16 -16 -17 -17 -17 -16 -15 -15 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -14 -14 -14 -13 -12 -13 -13 -13 -12 -11 -12 -12 -11 -11 -11 -11 -10 -9 -10 -10 -10 -11 -11 -12 -12 -11 -11 -11 -10 -10 -11 -11 -10 -10 -10 -10 -11 -12 -13 -12 -12 -11 -11 -11 -10 -11 -10 -11 -11 -12 -12 -13 -14 -15 -14 -15 -15 -14 -15 -14 -14 -15 -15 -16 -16 -17 -16 -15 -15 -15 -15 -16 -15 -15 -15 -15 -16 -15 -16 -16 -15 -15 -15 -14 -14 -15 -14 -14 -15 -15 -15 -16 -17 -16 -17 -16 -16 -15 -15 -15 -15 -15 -14 -13 -12 -13 -12 -13 -12 -12 -13 -13 -12 -12 -13 -14 -14 -15 -16 -16 -16 -17 -18 -19 -19 -18 -17 -17 -17 -16 -15 -16 -16 -16 -16 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -15 -15 -15 -15 -16 -17 -16 -15 -16 -16 -16 -16 -15 -15 -15 -16 -17 -17 -18 -18 -18 -17 -18 -17 -16 -17 -17 -18 -19 -18 -19 -19). b := RTGrapher new. b extent: 800 @ 500. ds := RTData new noDot; points: values; connectColor: Color red; yourself. b add: ds. b axisY minValue: values min; title: 'Skew'; color: Color black; noDecimal. b axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. b open 1) You can see the result in the TR Morph.png attached file. In X axis, how can set up a tick every certain step value? For example, every 50 points. Right now this is 88, 176, 264, 353 and I would like to be 50, 100, 150, 200, 250, 300, 350, 400. 2) I just plotted a very short toy DNA sequence, however if I would like to plot GC skew for E.coli that would take hundreds of points. The following script takes ages to complete or it never ends. You will find attached the necessary files: | grapher ds eColiGCSkew zipArchive | " The original dataset " "(ZnEasy get: 'http://bioinformaticsalgorithms.com/data/realdatasets/Replication/E_coli.txt') contents asDNASimpleSequence." "'/Users/mvs/Downloads/E_coli.txt' asFileReference size." "4639675" " GC Skew calc using BioSmalltalk " "eColiGCSkew := '/Users/mvs/Downloads/E_coli.txt' asFileReference contents asDNASimpleSequence gcSkewInt." " GC Skew already calculated in a FUEL compressed for this example, ecoligcskew.zip available at https://drive.google.com/file/d/1k9qayWrGkBEOeZ3Wb8TIJ80Rl-IR2Znx/view?usp=… " zipArchive := ZipArchive new. [ zipArchive readFrom: 'ecoligcskew.zip' fullName; extractAllTo: '.' ] ensure: [ zipArchive close ]. eColiGCSkew := FLMaterializer materializeFromFileNamed: 'OrderedCollection_3712516797.obj'. grapher := RTGrapher new extent: 800 @ 500; yourself. ds := RTData new noDot; points: eColiGCSkew; connectColor: Color red; yourself. grapher add: ds. grapher axisY minValue: eColiGCSkew min; title: 'Skew'; color: Color black; noDecimal. grapher axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. grapher open The skew_diagram_ecoli.png shows how the expected final plot should look like - obviously obtained with another software. What can I do to make it work in Roassal? Any suggestions here? Cheers, HernÃ¡n

2 7

Oct. 27, 2018

Hi, When loading XMLParserHTTP, I have an error when trying to inspect a parsed stream. It complains about SHTextStylerST80 being absent. Changing SHTextStylerST80 to SHRBTextStyler fix it. But I guess it will only work in Pharo 7, not 6 ? I include the filet of the method (couldnât publish the code). Cheers, CÃ©drick

1 0

ring deprecation in pharo 7
by Tudor Girba Oct. 26, 2018

Oct. 26, 2018

Hi, Ring seems to be deprecated in Pharo 7. Is there something else it will be replaced with? In particular, I am looking for the correct class that should correspond to RGMethodDefinition. Cheers, Doru -- www.feenk.com "Value is always contextual."

4 5

Pharo for PWAs and Web Push Notifications
by Rafael Luque Oct. 24, 2018

Oct. 24, 2018

Hi all, I'm interested in developing progressive web applications (PWA) [1] in Pharo, so I'd like to know if anyone has been involved in such kind of task before and could share his experiences. At first sight, I was thinking in trying PharoJS [2] to build abstractions in Pharo for each PWA's client-side concept like Service Workers, Cache API, IndexedDB API, appshell architecture, etc. By the other hand, one of the more appealing features of PWAs is the web push notifications capability. To be able to send push notifications from a Pharo server I will also need an implementation of the Web Push Protocol [3] and the VAPID spec [4]. Do you know any previous related work in Pharo or should I think in my own implementation? Thank you! [1] https://developers.google.com/web/progressive-web-apps/ [2] https://pharojs.github.io/ [3] https://tools.ietf.org/html/draft-ietf-webpush-protocol-12 [4] https://tools.ietf.org/html/draft-thomson-webpush-vapid-02

4 8