- Pharo-users - lists.pharo.org

[ANN] Iceberg v1.4.0
by Cyril Ferlicot Nov. 7, 2018

Nov. 7, 2018

Hello! This week we are releasing the version v1.4.0 of Iceberg. (https://github.com/pharo-vcs/iceberg/releases/tag/v1.4.0) This version is available in the latest Pharo 7. This release fixes a bug introduced in v1.3. It also add new features in the repository view, add some cleaning and also re-introduce a feature that was lost. Thanks to all contributors. Enjoy! Full changelog: Bugfixes #1068 'There is no associated repository configured.' warning on right clicking missing repository Features #1077 Repository view: Allow to collapse branches/remotes/tags trees #847 Move tags under remotes in Repository view #1070 set upstream if missing Cleanups #1066 Pharo 7: PackageManifest subclasses should be packaged with "Manifest" #1015 Replace usages of Glamour in the Github Plugin #1063 1061-Introduce-iconNamed-in-IceDefinition-and-IceTipModel-and-remove-all-the-terrible-Smalltalk-ui-icons -- Cyril Ferlicot https://ferlicot.fr

2 1

nested json problem
by Roelof Wobben Nov. 5, 2018

Nov. 5, 2018

3 5

git repos cloned into unexpected directory
by Arturo Zambrano Nov. 5, 2018

Nov. 5, 2018

Hi! I'm getting the following strange behavior using Iceberg in Pharo7 . My setup is like this: - Using Pharo Launcher - have several images I notice that when I clone a repository it is correctly downloaded into pharo-local/icerberg of that image. When I load a baseline of that project, that fires the download of several github repos, they are NOT stored in pharo-local/iceberg for the current image. Instead, they stored in pharo-local of an old image. I even tried deleting the whole old image directory (the one that pharo launcher creates). The result is the same, all the dependencies are stored in that directory (something recreates that). As a result several images are sharing a common iceberg location for dependencies ... I checked that I don't have enabled "Share repositories between images". Is there some settings file shared between all the pharo launcher managed images? Thanks!

2 2

glamorous toolkit alpha.2
by Tudor Girba Nov. 1, 2018

Nov. 1, 2018

Hi, Glamorous Toolkit has evolved quite a bit over the past months, and we now would like to announce that we reached alpha.2 version. It runs on top of Pharo 7: feenk.com/gt There quite a number of new things. Some highlights are: - We added extensive documentation for GT, Bloc and Brick. By running "GtWorld openTourâ you essentially transform the image into an elaborate wiki. - We worked on Coder, a new set of tools that are dedicated for affecting code. For example, in the picture below we see an editor on embedded examples that can be edited and run independently. And this one shows how we can visualize and edit the result of querying. Just a note: To make Coder work the way we want, we extended Brick with several widgets, and enhanced significantly the linear and grid layouts. - We added the first version of xdoc in order to serialize the Playground every time you evaluate something. As always, we are looking forward to your feedback. Have fun, The feenk team -- www.feenk.com -- www.feenk.com "Every thing should have the right to be different."

3 2

Http persistent connections
by Jimmie Houchin Oct. 31, 2018

Oct. 31, 2018

Hello, I am writing an app which accesses a REST api. The documentation says this. Connection Limits To provide equal resources to all clients, we recommend limiting both the number of new connections per second, and the number of requests per second made on a persistent connection (see above/below). For new connections, we recommend you limit this to twice per second (2/s). Establishing a new TCP and SSL connection is expensive for both client and server. To allow a better experience, using a persistent connection will allow more requests to be performed on an established connection. For an established connection, we recommend limiting this to one hundred per second (100/s). Please see following section on persistent connections to learn how to maintain a connection once it is established. HTTP Persistent Connection This keeps the underlying TCP connection active for multiple requests/responses. Subsequent requests will result in reduced latency as the TCP handshaking process is no longer required. If you are using an HTTP 1.0 client, ensure it supports the keep-alive directive and submit the header |Connection: Keep-Alive| with your request. Keep-Alive is part of the protocol in HTTP 1.1 and enabled by default on compliant clients. However, you will have to ensure your implementation does not set the connection header to other values. I do not know how to reuse a connection. I see in ZnClient #canReuseConnection and #connectionReuseTimeout. Is the timeout from connection time or last request or access time? Does that handle everything automatically for me? I will be accessing this api multiple times a minute, sometimes multiple times a second for almost all the time. How long can I keep a persistent connection open? What are best practices? Any help and wisdom greatly appreciated. Thanks. Jimmie

2 2

Fwd: Plotting genome scale values with Roassal
by HernÃ¡n Morales Durand Oct. 29, 2018

Oct. 29, 2018

Hi, I have a couple of Roassal questions regarding how to customize the plots of a genome metric known as GC skew, and how to scale the visualization to cover a (bacterial) genome scale data. For a toy example, I have isolated a Roassal sample code below from BioSmalltalk to show how I did an initial GC skew graphic: | b values ds | values := 'GGCTGCGTTCCCCTCAGTTAGCGCCTATCCTAAGCAGATCTGTAGTTAGTACTGTCTAAGCTTGTTAGACTACTCGGAACTTGCTGATATTAACCTTACCCCCGTCGAAACGCTTATTCCGCTTTGCTACTTCAAGCCCTGTAACATCTACTGTACTGACAAGGTTGCAGTAGCAATTGGCAAGGCTGTTTGGCATCTCAGATGACAGTTACCCGTGTTGCGCTCACCCGCAGCGACTCTCGGATACGTAACGCAGAAGACGTCTTCCGCGAGATTTGGGCGCGTCTGTCCACCTTCCCAGGTTGGCATTGGCAGAAGCTCTATCCGGCTTTGTTCCTCTAGCGGCTCCGCA' asDNASimpleSequence gcSkewInt. values := #(0 1 2 1 1 2 1 2 2 2 1 0 -1 -2 -2 -3 -3 -2 -2 -2 -2 -1 -2 -1 -2 -3 -3 -3 -3 -4 -5 -5 -5 -5 -4 -5 -5 -4 -4 -4 -5 -5 -4 -4 -4 -3 -3 -3 -3 -2 -2 -2 -3 -3 -2 -2 -3 -3 -3 -3 -2 -3 -3 -3 -2 -2 -2 -2 -1 -1 -2 -2 -2 -3 -3 -4 -3 -2 -2 -2 -3 -3 -3 -2 -3 -3 -2 -2 -2 -2 -2 -2 -2 -2 -3 -4 -4 -4 -4 -5 -6 -7 -8 -9 -8 -8 -9 -8 -8 -8 -8 -9 -8 -9 -9 -9 -9 -9 -9 -10 -11 -10 -11 -11 -11 -11 -10 -11 -11 -11 -12 -12 -12 -13 -13 -13 -12 -13 -14 -15 -15 -14 -14 -14 -14 -15 -15 -15 -16 -16 -16 -17 -17 -16 -16 -16 -17 -17 -16 -16 -17 -17 -17 -16 -15 -15 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -14 -14 -14 -13 -12 -13 -13 -13 -12 -11 -12 -12 -11 -11 -11 -11 -10 -9 -10 -10 -10 -11 -11 -12 -12 -11 -11 -11 -10 -10 -11 -11 -10 -10 -10 -10 -11 -12 -13 -12 -12 -11 -11 -11 -10 -11 -10 -11 -11 -12 -12 -13 -14 -15 -14 -15 -15 -14 -15 -14 -14 -15 -15 -16 -16 -17 -16 -15 -15 -15 -15 -16 -15 -15 -15 -15 -16 -15 -16 -16 -15 -15 -15 -14 -14 -15 -14 -14 -15 -15 -15 -16 -17 -16 -17 -16 -16 -15 -15 -15 -15 -15 -14 -13 -12 -13 -12 -13 -12 -12 -13 -13 -12 -12 -13 -14 -14 -15 -16 -16 -16 -17 -18 -19 -19 -18 -17 -17 -17 -16 -15 -16 -16 -16 -16 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -15 -15 -15 -15 -16 -17 -16 -15 -16 -16 -16 -16 -15 -15 -15 -16 -17 -17 -18 -18 -18 -17 -18 -17 -16 -17 -17 -18 -19 -18 -19 -19). b := RTGrapher new. b extent: 800 @ 500. ds := RTData new noDot; points: values; connectColor: Color red; yourself. b add: ds. b axisY minValue: values min; title: 'Skew'; color: Color black; noDecimal. b axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. b open 1) You can see the result in the TR Morph.png attached file. In X axis, how can set up a tick every certain step value? For example, every 50 points. Right now this is 88, 176, 264, 353 and I would like to be 50, 100, 150, 200, 250, 300, 350, 400. 2) I just plotted a very short toy DNA sequence, however if I would like to plot GC skew for E.coli that would take hundreds of points. The following script takes ages to complete or it never ends. You will find attached the necessary files: | grapher ds eColiGCSkew zipArchive | " The original dataset " "(ZnEasy get: 'http://bioinformaticsalgorithms.com/data/realdatasets/Replication/E_coli.txt') contents asDNASimpleSequence." "'/Users/mvs/Downloads/E_coli.txt' asFileReference size." "4639675" " GC Skew calc using BioSmalltalk " "eColiGCSkew := '/Users/mvs/Downloads/E_coli.txt' asFileReference contents asDNASimpleSequence gcSkewInt." " GC Skew already calculated in a FUEL compressed for this example, ecoligcskew.zip available at https://drive.google.com/file/d/1k9qayWrGkBEOeZ3Wb8TIJ80Rl-IR2Znx/view?usp=… " zipArchive := ZipArchive new. [ zipArchive readFrom: 'ecoligcskew.zip' fullName; extractAllTo: '.' ] ensure: [ zipArchive close ]. eColiGCSkew := FLMaterializer materializeFromFileNamed: 'OrderedCollection_3712516797.obj'. grapher := RTGrapher new extent: 800 @ 500; yourself. ds := RTData new noDot; points: eColiGCSkew; connectColor: Color red; yourself. grapher add: ds. grapher axisY minValue: eColiGCSkew min; title: 'Skew'; color: Color black; noDecimal. grapher axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. grapher open The skew_diagram_ecoli.png shows how the expected final plot should look like - obviously obtained with another software. What can I do to make it work in Roassal? Any suggestions here? Cheers, HernÃ¡n

2 7

XMLHTTPParser - Highlighting error when inspecting a parsed XML/HTML in P7
by CÃ©drick BÃ©ler Oct. 27, 2018

Oct. 27, 2018

Hi, When loading XMLParserHTTP, I have an error when trying to inspect a parsed stream. It complains about SHTextStylerST80 being absent. Changing SHTextStylerST80 to SHRBTextStyler fix it. But I guess it will only work in Pharo 7, not 6 ? I include the filet of the method (couldnât publish the code). Cheers, CÃ©drick

1 0

ring deprecation in pharo 7
by Tudor Girba Oct. 26, 2018

Oct. 26, 2018

Hi, Ring seems to be deprecated in Pharo 7. Is there something else it will be replaced with? In particular, I am looking for the correct class that should correspond to RGMethodDefinition. Cheers, Doru -- www.feenk.com "Value is always contextual."

4 5

Pharo for PWAs and Web Push Notifications
by Rafael Luque Oct. 24, 2018

Oct. 24, 2018

Hi all, I'm interested in developing progressive web applications (PWA) [1] in Pharo, so I'd like to know if anyone has been involved in such kind of task before and could share his experiences. At first sight, I was thinking in trying PharoJS [2] to build abstractions in Pharo for each PWA's client-side concept like Service Workers, Cache API, IndexedDB API, appshell architecture, etc. By the other hand, one of the more appealing features of PWAs is the web push notifications capability. To be able to send push notifications from a Pharo server I will also need an implementation of the Web Push Protocol [3] and the VAPID spec [4]. Do you know any previous related work in Pharo or should I think in my own implementation? Thank you! [1] https://developers.google.com/web/progressive-web-apps/ [2] https://pharojs.github.io/ [3] https://tools.ietf.org/html/draft-ietf-webpush-protocol-12 [4] https://tools.ietf.org/html/draft-thomson-webpush-vapid-02

4 8

Re: [Pharo-users] Pharo2VW (Was:[vwnc] Parsing in Smalltalk)
by Steffen MÃ¤rcker Oct. 24, 2018

Oct. 24, 2018

You're welcome. =) I really like the tool as it makes cross-platform-life a lot easier. I really wish there was a similar tool for the reverse direction, too! Cheers! Steffen Am .10.2018, 22:38 Uhr, schrieb Alexandre Bergel via Pharo-users <pharo-users(a)lists.pharo.org>: > Thanks Steffen for your contribution to Pharo2VW. > We reviewed and accepted your PullRequests. > > Alexandre > >> On Oct 19, 2018, at 6:29 AM, Steffen MÃ¤rcker <merkste(a)web.de> wrote: >> >> Nevermind, I figured it out easily. Must been blind before. >> >> Many thanks to the Iceberg team, the tool works like a charm in 6.1! >> >> >> Am .10.2018, 10:58 Uhr, schrieb Steffen MÃ¤rcker <merkste(a)web.de>: >> <---Schnitt---> >> > >

2 1