October 2018 - Pharo-users - lists.pharo.org

Re: [Pharo-users] [Pharo-dev] [ANN] Success story Mobility Map

by Marcus Denker

The Slides from the ESUG presentation are now inline here: https://www.slideshare.net/zweidenker/docker-and-pharo-zweidenker >>> >>> As presented on ESUG here is the brief description of one of our current projects. >>> >>> Mobility Map >>> ââââââ >>> >>> Mobility Map is a broker for mobility services. It offers multi-modal routing search enabling users to find the best travel options between locations. Travel options include car sharing, bikes, trains, busses etc. Rented cars can be offered for ride sharing on booking time letting other people find it to participate in the ride. Single travel options are combined in travel plans that can be booked and managed in a very easy way. >>> >>> For this project main requirements were scalability to serve a large user base and flexibility to add more additional providers to the broker. The application has been realized using web technologies for the frontend and pharo for the backend. Using a microservice architecture combined with a broker it is easy to extend the platform with additional brokers. Deployment is done using docker swarm for distributing dozens of pharo images among multiple server machines connected by a message queue for the communication. Pharo supported that scenario very well enabling us the meet the requirements with less effort. >>> >>> Pharo turned out to be a perfect fit to develop the application in a agile way. Small development cycles with continuous integration and continuous delivery enables fast turnarounds for the customers to validate progress. >>> >>> This is a screenshot of the search page for multi-modal results: >>> >>> >>> <Screen Shot 2018-09-21 at 16.54.30.png> >> >> > >

Oct. 2, 2018

Re: [Pharo-users] Iceberg - better control of project name?

by Guillermo Polito

Issue: https://github.com/pharo-vcs/iceberg/issues/1009 On Tue, Oct 2, 2018 at 10:02 AM Guillermo Polito <guillermopolito(a)gmail.com> wrote: > Aaand the mail got sent before :) > > Then two other comments that are related or I'd like to discuss: > - So far we can allow in iceberg several projects with the same name. > That is not a problem, so you can clone the same project from two different > repositories. Of course this would mean that one will be dirty all the time > (in comparison against the image). > - I'd like to "rethink" the directory structure. We have chosen to use > {owner}/{repository} for some time now, but that is only valid for those > hostings that store repositories under a username (e.g., > github/gitlab/bitbucket) and is not valid for other kind of git > hostings/server (e.g., a home gitolite). > This makes that the directory where the repositories are, suddenly > mixes different structures {owner}/{repository} and {repository}, and we > pay that lack of coherence afterwards... But making a purely flat structure > will cause much more name clashes. And there is some story with Metacello > compatibility around it too! > I'm just not sure what is the bestish solution here. Maybe what we > have is good enough, but if somebody would like to prototype around this, > I'd be glad to learn more about pros and cons ^^. > > On Tue, Oct 2, 2018 at 9:51 AM Guillermo Polito <guillermopolito(a)gmail.com> > wrote: > >> Yes, I agree with most of the comments here. I'll try to summarize: >> >> - we should be able to specify the name of a project independently of >> their location/repository name >> - Maybe, for old projects that don't have a name, we could initialize a >> project's name as it's repository name? >> >> On Tue, Oct 2, 2018 at 5:07 AM Tim Mackinnon <tim(a)testit.works> wrote: >> >>> Sounds like the user override is what we are after - I guess we need to >>> make a pr ... sadly my laptop has died so itâs not going to be me for a >>> little while until I can find an Apple store on my travels. >>> >>> Tim >>> >>> Sent from my iPhone >>> >>> On 2 Oct 2018, at 12:30, Ben Coman <btc(a)openinworld.com> wrote: >>> >>> >>> >>> On Mon, 1 Oct 2018 at 23:16, Sean P. DeNigris <sean(a)clipperadams.com> >>> wrote: >>> >>>> Tim Mackinnon wrote >>>> > either by showing {owner}/{project} >>>> >>>> What about when there are multiple remotes? >>>> >>> >>> +1 to what you imply here, that the owner/remote should not be >>> auto-coded into the project name. >>> Remote are well handled within Iceberg. >>> The user though could add the owner as free text into a custom project >>> name i.e. "owner-project" >>> >>> cheers -ben >>> >>> >>> >> >> -- >> >> >> >> Guille Polito >> >> Research Engineer >> >> Centre de Recherche en Informatique, Signal et Automatique de Lille >> >> CRIStAL - UMR 9189 >> >> French National Center for Scientific Research - *http://www.cnrs.fr >> <http://www.cnrs.fr>* >> >> >> *Web:* *http://guillep.github.io* <http://guillep.github.io> >> >> *Phone: *+33 06 52 70 66 13 >> > > > -- > > > > Guille Polito > > Research Engineer > > Centre de Recherche en Informatique, Signal et Automatique de Lille > > CRIStAL - UMR 9189 > > French National Center for Scientific Research - *http://www.cnrs.fr > <http://www.cnrs.fr>* > > > *Web:* *http://guillep.github.io* <http://guillep.github.io> > > *Phone: *+33 06 52 70 66 13 > -- Guille Polito Research Engineer Centre de Recherche en Informatique, Signal et Automatique de Lille CRIStAL - UMR 9189 French National Center for Scientific Research - *http://www.cnrs.fr <http://www.cnrs.fr>* *Web:* *http://guillep.github.io* <http://guillep.github.io> *Phone: *+33 06 52 70 66 13

Oct. 2, 2018

Re: [Pharo-users] Iceberg - better control of project name?

by Guillermo Polito

Aaand the mail got sent before :) Then two other comments that are related or I'd like to discuss: - So far we can allow in iceberg several projects with the same name. That is not a problem, so you can clone the same project from two different repositories. Of course this would mean that one will be dirty all the time (in comparison against the image). - I'd like to "rethink" the directory structure. We have chosen to use {owner}/{repository} for some time now, but that is only valid for those hostings that store repositories under a username (e.g., github/gitlab/bitbucket) and is not valid for other kind of git hostings/server (e.g., a home gitolite). This makes that the directory where the repositories are, suddenly mixes different structures {owner}/{repository} and {repository}, and we pay that lack of coherence afterwards... But making a purely flat structure will cause much more name clashes. And there is some story with Metacello compatibility around it too! I'm just not sure what is the bestish solution here. Maybe what we have is good enough, but if somebody would like to prototype around this, I'd be glad to learn more about pros and cons ^^. On Tue, Oct 2, 2018 at 9:51 AM Guillermo Polito <guillermopolito(a)gmail.com> wrote: > Yes, I agree with most of the comments here. I'll try to summarize: > > - we should be able to specify the name of a project independently of > their location/repository name > - Maybe, for old projects that don't have a name, we could initialize a > project's name as it's repository name? > > On Tue, Oct 2, 2018 at 5:07 AM Tim Mackinnon <tim(a)testit.works> wrote: > >> Sounds like the user override is what we are after - I guess we need to >> make a pr ... sadly my laptop has died so itâs not going to be me for a >> little while until I can find an Apple store on my travels. >> >> Tim >> >> Sent from my iPhone >> >> On 2 Oct 2018, at 12:30, Ben Coman <btc(a)openinworld.com> wrote: >> >> >> >> On Mon, 1 Oct 2018 at 23:16, Sean P. DeNigris <sean(a)clipperadams.com> >> wrote: >> >>> Tim Mackinnon wrote >>> > either by showing {owner}/{project} >>> >>> What about when there are multiple remotes? >>> >> >> +1 to what you imply here, that the owner/remote should not be auto-coded >> into the project name. >> Remote are well handled within Iceberg. >> The user though could add the owner as free text into a custom project >> name i.e. "owner-project" >> >> cheers -ben >> >> >> > > -- > > > > Guille Polito > > Research Engineer > > Centre de Recherche en Informatique, Signal et Automatique de Lille > > CRIStAL - UMR 9189 > > French National Center for Scientific Research - *http://www.cnrs.fr > <http://www.cnrs.fr>* > > > *Web:* *http://guillep.github.io* <http://guillep.github.io> > > *Phone: *+33 06 52 70 66 13 > -- Guille Polito Research Engineer Centre de Recherche en Informatique, Signal et Automatique de Lille CRIStAL - UMR 9189 French National Center for Scientific Research - *http://www.cnrs.fr <http://www.cnrs.fr>* *Web:* *http://guillep.github.io* <http://guillep.github.io> *Phone: *+33 06 52 70 66 13

Oct. 2, 2018

Re: [Pharo-users] Iceberg - better control of project name?

by Guillermo Polito

Yes, I agree with most of the comments here. I'll try to summarize: - we should be able to specify the name of a project independently of their location/repository name - Maybe, for old projects that don't have a name, we could initialize a project's name as it's repository name? On Tue, Oct 2, 2018 at 5:07 AM Tim Mackinnon <tim(a)testit.works> wrote: > Sounds like the user override is what we are after - I guess we need to > make a pr ... sadly my laptop has died so itâs not going to be me for a > little while until I can find an Apple store on my travels. > > Tim > > Sent from my iPhone > > On 2 Oct 2018, at 12:30, Ben Coman <btc(a)openinworld.com> wrote: > > > > On Mon, 1 Oct 2018 at 23:16, Sean P. DeNigris <sean(a)clipperadams.com> > wrote: > >> Tim Mackinnon wrote >> > either by showing {owner}/{project} >> >> What about when there are multiple remotes? >> > > +1 to what you imply here, that the owner/remote should not be auto-coded > into the project name. > Remote are well handled within Iceberg. > The user though could add the owner as free text into a custom project > name i.e. "owner-project" > > cheers -ben > > > -- Guille Polito Research Engineer Centre de Recherche en Informatique, Signal et Automatique de Lille CRIStAL - UMR 9189 French National Center for Scientific Research - *http://www.cnrs.fr <http://www.cnrs.fr>* *Web:* *http://guillep.github.io* <http://guillep.github.io> *Phone: *+33 06 52 70 66 13

Oct. 2, 2018

Re: [Pharo-users] Image does not start anymore

by Bernhard Pieber

Hi Vincent, Thanks for taking the time to answer. Yes, I have the same error every time. I tried with the latest stable Squeak VM. However, I get an error âExternal module not foundâ for libgit2.dll. I am afraid I cannot provide the image because the data it contains is sensitive. I will look into Epicea next. Cheers, Bernhard > Am 01.10.2018 um 18:09 schrieb <Vincent.Blondeau(a)lamresearch.com> <Vincent.Blondeau(a)lamresearch.com>: > > Hi, > > That is weird. It seems that you should have some debugging process running... Do you have the same error if you try again? So can also try with a squeak VM which is more simple. > You can always retrieve your changes with Epicea (see Gif) and you playground code (see in the play cache folder). > > Worse case, I can try something to get your data back but without any guaranty that it will work because it implies to play with the image bytecode. > > Cheers, > Vincent > > -----Original Message----- > From: Pharo-users <pharo-users-bounces(a)lists.pharo.org> On Behalf Of Bernhard Pieber > Sent: Saturday, September 29, 2018 9:07 > To: Any question about pharo is welcome <pharo-users(a)lists.pharo.org> > Subject: [Pharo-users] Image does not start anymore > > Hi, > > I have a Pharo 7 image which I normally start from Pharo Launcher on Windows. I think I saved it without problems. However, suddenly it stopped opening. As it contains data and some unsaved code I would hate to loose, I'd appreciate any help on how to debug a situation like this. I attached the debug log. > > Cheers, > Bernhard > <2018-10-01_09-03-51.gif>

Oct. 2, 2018

Re: [Pharo-users] [ANN] Migrated Artefact to GitHub

by Offray Vladimir Luna CÃ¡rdenas

Hi, Hopefully someone will do it soon, because we are just starting our second week of "Visualizar 2018"[1] in Medialab Prado, a intesive two weeks data visualization prototyping meeting and we'll iterate on our Data Selfies project using Pharo, Grafoscopio and agile visualization[2] and something like Artifact would be handy to compose the final custom visualization[3] this week. [1] https://www.medialab-prado.es/programas/visualizar18-datos-personales [2] https://docutopia.tupale.co/vis18:dataselfies# [3] https://docutopia.tupale.co/HbIK-fjrRlyZt2en0Nf2Qw# So as soon as someone has a repository with a readme to install Artifact, let me know ;-). Cheers, Offray On 10/1/18 8:06 AM, Guillermo Polito wrote: > But this was really not against you Norbert, so really no apologies > are needed :), that's why I said that "I hope nobody thinks like that". > I should apologize for reacting in that case ^^. > > The thing is that it can be frustrating to send an email and see that > lots of people focus on something negative or how non-perfect it is :). > And I feel that if that energy spent on criticizing was put on > collaborating, we could have something much better! > > I've checked my disk and I still have a copy of the repository. > But I've decided I'll post my changes as a Pull Request when somebody > migrates the repository. > > Guille > > On Sun, Sep 30, 2018 at 10:32 AM Norbert Hartl <norbert(a)hartl.name > <mailto:norbert@hartl.name>> wrote: > > I think I need to apologize. I did not see how my mail could be > read. I would never accuse you of taking ownership of something > you did not do. Because I know you wouldnât do something like > that. It just makes me wonder that you donât know me good enough > to know that I would not accuse you of that. I was referring to > the removal of prior contributions. > Anyway the way I wrote it was unfortunate and my apologies again. > > I donât need to write much more because I can subscribe myself to > everything Peter said. We should not asking for contributions if > we donât treat them as something valuable. > > Of course nobody has time to do stuff. But in this case we have a > tool that costs only a couple of minutes and saves a lot stuff of > value. So I didnât mean you have to do it but someone. And I just > wanted to be to consider using the git migration tool in th > future. There was no need to kill your repo because the history > can be added and your changes can be rebased on that. That is what > git gives us. > > And finally Iâm asking everone to take care. I need to take care > more about what I write. But people that get easily offended > should see that is the other part of the problem. > > Norbert > > > Am 29.09.2018 um 01:13 schrieb Cyril Ferlicot D. > <cyril.ferlicot(a)gmail.com <mailto:cyril.ferlicot@gmail.com>>: > > > >> Le 29/09/2018 Ã 01:05, Guillermo Polito a Ã©crit : > >> I'm sorry if I offended somebody. I've deleted the repository > (it was > >> under pharo-repository, not under my name). With it the changes > I made > >> to make it work on Pharo7. > >> > >> I understand that Peter's tool is easy, i've used it before. > >> But I have my constraints, as others has theirs. > >> Just note that lot of people complained but nobody took the work to > >> migrate it with Peter's tool. > >> Why? If that's so easy :) > >> > >> So I decided I was going to spend only ~1hour. It was > >>Â - Find the right code on sthub (Rmod repository or another one?) > >>Â - loading the code + doing a commit (couple of minutes) > >>Â - adapting the code for pharo 7 > >>Â - writing a baseline and testing it worked (in a new image, > loading > >> dependencies) > >>Â - writing a readme, putting a link to the website > >> > >> All of them are little tasks of a couple of minutes. Count > interruptions > >> in the middle. > >> And now I'm sending this email out of frustration. > >> > > > > Hi Guille, > > > > If I can be added to pharo-contribution team I can do the > migration with > > history in the next days (weeks max). > > > > And thank you for all the work you are doing on a lot of projects! > > > >> > >> -- > >> > >>Â Â > >> > >>Â Â > >> > >> Guille Polito > >> > >> Research Engineer > >> > >> Centre de Recherche en Informatique, Signal et Automatique de Lille > >> > >> CRIStAL - UMR 9189 > >> > >> French National Center for Scientific Research - > _http://www.cnrs.fr_ > >> > >> > >> *Web:* _http://guillep.github.io_ > >> > >> *Phone: *+33 06 52 70 66 13 > >> > > > > > > -- > > Cyril Ferlicot > > https://ferlicot.fr > > > > > > > -- > > Â Â Â > > > > Guille Polito > > Research Engineer > > Centre de Recherche en Informatique, Signal et Automatique de Lille > > CRIStAL - UMR 9189 > > French National Center for Scientific Research - _http://www.cnrs.fr_ > > > *Web:* _http://guillep.github.io_ > > *Phone: *+33 06 52 70 66 13 >

Oct. 2, 2018

Fwd: Plotting genome scale values with Roassal

by HernÃ¡n Morales Durand

Hi, I have a couple of Roassal questions regarding how to customize the plots of a genome metric known as GC skew, and how to scale the visualization to cover a (bacterial) genome scale data. For a toy example, I have isolated a Roassal sample code below from BioSmalltalk to show how I did an initial GC skew graphic: | b values ds | values := 'GGCTGCGTTCCCCTCAGTTAGCGCCTATCCTAAGCAGATCTGTAGTTAGTACTGTCTAAGCTTGTTAGACTACTCGGAACTTGCTGATATTAACCTTACCCCCGTCGAAACGCTTATTCCGCTTTGCTACTTCAAGCCCTGTAACATCTACTGTACTGACAAGGTTGCAGTAGCAATTGGCAAGGCTGTTTGGCATCTCAGATGACAGTTACCCGTGTTGCGCTCACCCGCAGCGACTCTCGGATACGTAACGCAGAAGACGTCTTCCGCGAGATTTGGGCGCGTCTGTCCACCTTCCCAGGTTGGCATTGGCAGAAGCTCTATCCGGCTTTGTTCCTCTAGCGGCTCCGCA' asDNASimpleSequence gcSkewInt. values := #(0 1 2 1 1 2 1 2 2 2 1 0 -1 -2 -2 -3 -3 -2 -2 -2 -2 -1 -2 -1 -2 -3 -3 -3 -3 -4 -5 -5 -5 -5 -4 -5 -5 -4 -4 -4 -5 -5 -4 -4 -4 -3 -3 -3 -3 -2 -2 -2 -3 -3 -2 -2 -3 -3 -3 -3 -2 -3 -3 -3 -2 -2 -2 -2 -1 -1 -2 -2 -2 -3 -3 -4 -3 -2 -2 -2 -3 -3 -3 -2 -3 -3 -2 -2 -2 -2 -2 -2 -2 -2 -3 -4 -4 -4 -4 -5 -6 -7 -8 -9 -8 -8 -9 -8 -8 -8 -8 -9 -8 -9 -9 -9 -9 -9 -9 -10 -11 -10 -11 -11 -11 -11 -10 -11 -11 -11 -12 -12 -12 -13 -13 -13 -12 -13 -14 -15 -15 -14 -14 -14 -14 -15 -15 -15 -16 -16 -16 -17 -17 -16 -16 -16 -17 -17 -16 -16 -17 -17 -17 -16 -15 -15 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -14 -14 -14 -13 -12 -13 -13 -13 -12 -11 -12 -12 -11 -11 -11 -11 -10 -9 -10 -10 -10 -11 -11 -12 -12 -11 -11 -11 -10 -10 -11 -11 -10 -10 -10 -10 -11 -12 -13 -12 -12 -11 -11 -11 -10 -11 -10 -11 -11 -12 -12 -13 -14 -15 -14 -15 -15 -14 -15 -14 -14 -15 -15 -16 -16 -17 -16 -15 -15 -15 -15 -16 -15 -15 -15 -15 -16 -15 -16 -16 -15 -15 -15 -14 -14 -15 -14 -14 -15 -15 -15 -16 -17 -16 -17 -16 -16 -15 -15 -15 -15 -15 -14 -13 -12 -13 -12 -13 -12 -12 -13 -13 -12 -12 -13 -14 -14 -15 -16 -16 -16 -17 -18 -19 -19 -18 -17 -17 -17 -16 -15 -16 -16 -16 -16 -15 -14 -15 -15 -14 -14 -14 -13 -14 -14 -15 -15 -15 -15 -16 -17 -16 -15 -16 -16 -16 -16 -15 -15 -15 -16 -17 -17 -18 -18 -18 -17 -18 -17 -16 -17 -17 -18 -19 -18 -19 -19). b := RTGrapher new. b extent: 800 @ 500. ds := RTData new noDot; points: values; connectColor: Color red; yourself. b add: ds. b axisY minValue: values min; title: 'Skew'; color: Color black; noDecimal. b axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. b open 1) You can see the result in the TR Morph.png attached file. In X axis, how can set up a tick every certain step value? For example, every 50 points. Right now this is 88, 176, 264, 353 and I would like to be 50, 100, 150, 200, 250, 300, 350, 400. 2) I just plotted a very short toy DNA sequence, however if I would like to plot GC skew for E.coli that would take hundreds of points. The following script takes ages to complete or it never ends. You will find attached the necessary files: | grapher ds eColiGCSkew zipArchive | " The original dataset " "(ZnEasy get: 'http://bioinformaticsalgorithms.com/data/realdatasets/Replication/E_coli.txt') contents asDNASimpleSequence." "'/Users/mvs/Downloads/E_coli.txt' asFileReference size." "4639675" " GC Skew calc using BioSmalltalk " "eColiGCSkew := '/Users/mvs/Downloads/E_coli.txt' asFileReference contents asDNASimpleSequence gcSkewInt." " GC Skew already calculated in a FUEL compressed for this example, ecoligcskew.zip available at https://drive.google.com/file/d/1k9qayWrGkBEOeZ3Wb8TIJ80Rl-IR2Znx/view?usp=… " zipArchive := ZipArchive new. [ zipArchive readFrom: 'ecoligcskew.zip' fullName; extractAllTo: '.' ] ensure: [ zipArchive close ]. eColiGCSkew := FLMaterializer materializeFromFileNamed: 'OrderedCollection_3712516797.obj'. grapher := RTGrapher new extent: 800 @ 500; yourself. ds := RTData new noDot; points: eColiGCSkew; connectColor: Color red; yourself. grapher add: ds. grapher axisY minValue: eColiGCSkew min; title: 'Skew'; color: Color black; noDecimal. grapher axisX numberOfTicks: 10; noDecimal; color: Color black; title: 'Position'. grapher open The skew_diagram_ecoli.png shows how the expected final plot should look like - obviously obtained with another software. What can I do to make it work in Roassal? Any suggestions here? Cheers, HernÃ¡n

Oct. 2, 2018

Re: [Pharo-users] Iceberg - better control of project name?

by Tim Mackinnon

Sounds like the user override is what we are after - I guess we need to make a pr ... sadly my laptop has died so itâs not going to be me for a little while until I can find an Apple store on my travels. Tim Sent from my iPhone > On 2 Oct 2018, at 12:30, Ben Coman <btc(a)openinworld.com> wrote: > > > >> On Mon, 1 Oct 2018 at 23:16, Sean P. DeNigris <sean(a)clipperadams.com> wrote: >> Tim Mackinnon wrote >> > either by showing {owner}/{project} >> >> What about when there are multiple remotes? > > +1 to what you imply here, that the owner/remote should not be auto-coded into the project name. > Remote are well handled within Iceberg. > The user though could add the owner as free text into a custom project name i.e. "owner-project" > > cheers -ben >

Oct. 2, 2018

Re: [Pharo-users] Image does not start anymore

by Ben Coman

On Tue, 2 Oct 2018 at 00:10, <Vincent.Blondeau(a)lamresearch.com> wrote: > Hi, > > That is weird. It seems that you should have some debugging process > running... Do you have the same error if you try again? So can also try > with a squeak VM which is more simple. > You can always retrieve your changes with Epicea (see Gif) and you > playground code (see in the play cache folder). > I'm guessing that would start by copying the ombu folders under pharo-local to a new image. cheers -ben

Oct. 1, 2018

Re: [Pharo-users] Iceberg - better control of project name?

by Ben Coman

On Mon, 1 Oct 2018 at 23:16, Sean P. DeNigris <sean(a)clipperadams.com> wrote: > Tim Mackinnon wrote > > either by showing {owner}/{project} > > What about when there are multiple remotes? > +1 to what you imply here, that the owner/remote should not be auto-coded into the project name. Remote are well handled within Iceberg. The user though could add the owner as free text into a custom project name i.e. "owner-project" cheers -ben

Oct. 1, 2018